| MirGeneDB ID | Ete-Mir-17-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-17 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ete-Mir-17-P1a Ete-Mir-17-P1c Ete-Mir-17-P1d Ete-Mir-17-P2c Ete-Mir-17-P4a Ete-Mir-17-P4c Ete-Mir-17-P4d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-17-P2a Ami-Mir-17-P2a Bta-Mir-17-P2a Cfa-Mir-17-P2a Cja-Mir-17-P2a Cli-Mir-17-P2a Cmi-Mir-17-P2a Cpi-Mir-17-P2a Cpo-Mir-17-P2a Dno-Mir-17-P2a Dre-Mir-17-P2a1 Dre-Mir-17-P2a2 Eca-Mir-17-P2a Gga-Mir-17-P2a Gja-Mir-17-P2a Gmo-Mir-17-P2a1 Gmo-Mir-17-P2a2 Hsa-Mir-17-P2a Laf-Mir-17-P2a Lch-Mir-17-P2a Loc-Mir-17-P2a Mal-Mir-17-P2a2a Mal-Mir-17-P2a2b Mdo-Mir-17-P2a Mml-Mir-17-P2a Mmr-Mir-17-P2a Mmu-Mir-17-P2a Mun-Mir-17-P2a Neu-Mir-17-P2a Oan-Mir-17-P2a Ocu-Mir-17-P2a Pab-Mir-17-P2a Pbv-Mir-17-P2a Rno-Mir-17-P2a Sha-Mir-17-P2a Spt-Mir-17-P2a Sto-Mir-17-P2a Tgu-Mir-17-P2a Tni-Mir-17-P2a1 Tni-Mir-17-P2a2 Xla-Mir-17-P2a3 Xla-Mir-17-P2a4 Xtr-Mir-17-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
JH980332: 5284712-5284776 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-17-P2a) |
Mir-92-P1a
JH980332: 5284156-5284214 [-]
UCSC
Mir-19-P2a JH980332: 5284271-5284331 [-] UCSC Mir-17-P4a JH980332: 5284407-5284465 [-] UCSC Mir-19-P1a JH980332: 5284571-5284628 [-] UCSC Mir-17-P2a JH980332: 5284712-5284776 [-] UCSC Mir-17-P1a JH980332: 5284858-5284917 [-] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAGGUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GGGCCUGCUGGUGUUGAGUGCUUUUUGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGAAGUUAUGUUUUCAUCCAAUAAUUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GGGCCUGCUGGUGUUGAGU-- U --| U UC U A UGAAGUA GCUUUUUGU CUA AGG GCA UAG GCAG UAG G UGAAGAAUA GGU UCC CGU AUC CGUC AUC A CUUAAUAACCUACUUUUGUAU C CU^ U GA C - UACGAUU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-17-P2a_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAAGGUGCAUCUAGUGCAGAUAG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-17-P2a_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- ACUGCCCUAAGUGCUCCUUCUGGC -65
Get sequence
|






