| MirGeneDB ID | Ete-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ete-Mir-92-P1a Ete-Mir-92-P1c Ete-Mir-92-P1d Ete-Mir-92-P2a Ete-Mir-92-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-92-P2c Ami-Mir-92-P2c Asu-Mir-92 Bfl-Mir-92-o2 Bla-Mir-92-o2 Bta-Mir-92-P2c Cel-Mir-92 Cfa-Mir-92-P2c Cja-Mir-92-P2c Cli-Mir-92-P2c Cmi-Mir-92-P2c Cpi-Mir-92-P2c Cpo-Mir-92-P2c Dno-Mir-92-P2c Dre-Mir-92-P2c Eca-Mir-92-P2c Esc-Mir-92 Gga-Mir-92-P2c Gja-Mir-92-P2c Gmo-Mir-92-P2c Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P2c Isc-Mir-92 Laf-Mir-92-P2c Lch-Mir-92-P2c Loc-Mir-92-P2c Mdo-Mir-92-P2c Mml-Mir-92-P2c Mmr-Mir-92-P2c Mmu-Mir-92-P2c Mun-Mir-92-P2c Neu-Mir-92-P2c Oan-Mir-92-P2c Obi-Mir-92 Ocu-Mir-92-P2c Pab-Mir-92-P2c Pbv-Mir-92-P2c Rno-Mir-92-P2c Sha-Mir-92-P2c Sme-Mir-92 Spt-Mir-92-P2c Sto-Mir-92-P2c Tgu-Mir-92-P2c Xla-Mir-92-P2c3 Xla-Mir-92-P2c4 Xtr-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
JH980394: 1010851-1010915 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P2c) |
Mir-17-P1c
JH980394: 1010060-1010118 [+]
UCSC
Mir-17-P2c JH980394: 1010215-1010279 [+] UCSC Mir-17-P4c JH980394: 1010443-1010503 [+] UCSC Mir-19-P2c JH980394: 1010568-1010631 [+] UCSC Mir-92-P1c JH980394: 1010699-1010759 [+] UCSC Mir-92-P2c JH980394: 1010851-1010915 [+] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UACUUAUAAAGUGACCUGUUUUGUUGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUUAGUAAGGUAGGAGAAAAAUUGCACGGUAUCCAUCUGGAAACCGCAAGACCUUCUUAUACCACUUGUCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UACUUAUAAAGUGACCU--| U GU CA A GAUUAGUA GUUUUGU GUU CGGGUGGAU CG UGCAAUUUU A CAGAACG CAA GUCUACCUA GC ACGUUAAAA G UCUGUUCACCAUAUUCUUC^ C AG UG - AGAGGAUG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-92-P2c_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGGGUGGAUCACGAUGCAAUUUU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-92-P2c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
43- AAUUGCACGGUAUCCAUCUGGA -65
Get sequence
|






