| MirGeneDB ID | Cpi-Mir-92-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Western painted turtle (Chrysemys picta bellii) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cpi-mir-92a-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cpi-Mir-92-P1a Cpi-Mir-92-P1d Cpi-Mir-92-P2a Cpi-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-92-P1c Ami-Mir-92-P1c Asu-Mir-92 Bfl-Mir-92-o1 Bla-Mir-92-o1 Bta-Mir-92-P1c Cel-Mir-92 Cfa-Mir-92-P1c Cja-Mir-92-P1c Cli-Mir-92-P1c Cmi-Mir-92-P1c Cpo-Mir-92-P1c Dno-Mir-92-P1c Eca-Mir-92-P1c Esc-Mir-92 Ete-Mir-92-P1c Gga-Mir-92-P1c Gja-Mir-92-P1c Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P1c Isc-Mir-92 Laf-Mir-92-P1c Mdo-Mir-92-P1c Mml-Mir-92-P1c Mmr-Mir-92-P1c Mmu-Mir-92-P1c Mun-Mir-92-P1c Neu-Mir-92-P1c Oan-Mir-92-P1c Obi-Mir-92 Ocu-Mir-92-P1c Pab-Mir-92-P1c Pbv-Mir-92-P1c Rno-Mir-92-P1c Sha-Mir-92-P1c Sme-Mir-92 Spt-Mir-92-P1c Sto-Mir-92-P1c Tgu-Mir-92-P1c Xla-Mir-92-P1c3 Xla-Mir-92-P1c4 Xtr-Mir-92-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (chrPic1) |
JH584720: 2634933-2634994 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P1c) |
Mir-17-P1c
JH584720: 2634299-2634357 [+]
UCSC
Ensembl
Mir-17-P2c JH584720: 2634454-2634518 [+] UCSC Ensembl Mir-17-P4c JH584720: 2634668-2634729 [+] UCSC Ensembl Mir-19-P2c JH584720: 2634792-2634851 [+] UCSC Ensembl Mir-92-P1c JH584720: 2634933-2634994 [+] UCSC Ensembl Mir-92-P2c JH584720: 2635069-2635133 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CGAAGAAGGCUUUUGCACUGGUUUCUCCAUGGGUGGGGAUUUGUUGCAUUACUUGUAGCUAUGUGUAGAGUAUUGCACUUGUCCCGGCCUGUGGAGGAAAGGAGGACUUGUCGCCAAUUCUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CGAAGAAGGCUUUUGCA---| GG G UU U U UGUAGCU CU UUUCUCCAUGGGU GGGAU GU GCA UACU \ GG AAGGAGGUGUCCG CCCUG CA CGU AUGA A GUCUUAACCGCUGUUCAGGA^ A- G UU - U GAUGUGU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Drosha cut +2 as a second Dicer cut +1 on the 5p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cpi-Mir-92-P1c_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0037700 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGGUGGGGAUUUGUUGCAUUACU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cpi-Mir-92-P1c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0037699 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- UAUUGCACUUGUCCCGGCCUGU -62
Get sequence
|






