| MirGeneDB ID | Pbv-Mir-92-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-92a-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-92-P1a Pbv-Mir-92-P1d Pbv-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-92-P1c Ami-Mir-92-P1c Asu-Mir-92 Bfl-Mir-92-o1 Bla-Mir-92-o1 Bta-Mir-92-P1c Cel-Mir-92 Cfa-Mir-92-P1c Cja-Mir-92-P1c Cli-Mir-92-P1c Cmi-Mir-92-P1c Cpi-Mir-92-P1c Cpo-Mir-92-P1c Dno-Mir-92-P1c Eca-Mir-92-P1c Esc-Mir-92 Ete-Mir-92-P1c Gga-Mir-92-P1c Gja-Mir-92-P1c Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P1c Isc-Mir-92 Laf-Mir-92-P1c Mdo-Mir-92-P1c Mml-Mir-92-P1c Mmr-Mir-92-P1c Mmu-Mir-92-P1c Mun-Mir-92-P1c Neu-Mir-92-P1c Oan-Mir-92-P1c Obi-Mir-92 Ocu-Mir-92-P1c Pab-Mir-92-P1c Rno-Mir-92-P1c Sha-Mir-92-P1c Sme-Mir-92 Spt-Mir-92-P1c Sto-Mir-92-P1c Tgu-Mir-92-P1c Xla-Mir-92-P1c3 Xla-Mir-92-P1c4 Xtr-Mir-92-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE958055.1: 286-347 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P1c) |
Mir-92-P2c
KE958055.1: 115-179 [-]
Mir-92-P1c KE958055.1: 286-347 [-] Mir-19-P2c KE958055.1: 454-514 [-] Mir-17-P4c KE958055.1: 600-662 [-] Mir-17-P2c KE958055.1: 3575-3639 [-] Mir-17-P1c KE958055.1: 3752-3809 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CGCAAAGGCAGAGAGAGCUCCUUCCUCCGUGGGUUGGGAUUUGUUGUAUUACUCGGAGAUCUCUGAACAGUAUUGCACUUGUCCCGGCCUGUGGAGGACCGGGGAGAAUCGACCUGGGCAGAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CGCAAAGGCAGAGAGAG- U-| UG UU U U CGGAGAU CUCC UCCUCCG GGUUGGGAU GU GUA UACU \ GGGG AGGAGGU CCGGCCCUG CA CGU AUGA C AGACGGGUCCAGCUAAGA CC^ GU UU - U CAAGUCU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-92-P1c_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGGUUGGGAUUUGUUGUAUUACU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-92-P1c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038889 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- UAUUGCACUUGUCCCGGCCUGU -62
Get sequence
|






